ID: 925609636_925609650

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 925609636 925609650
Species Human (GRCh38) Human (GRCh38)
Location 2:5692514-5692536 2:5692557-5692579
Sequence CCACCGCGCCGGCGGCCGTCGTC TGTGTGCAGCCTGGAAGGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 183} {0: 1, 1: 0, 2: 2, 3: 30, 4: 434}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!