ID: 925614337_925614346

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 925614337 925614346
Species Human (GRCh38) Human (GRCh38)
Location 2:5731260-5731282 2:5731309-5731331
Sequence CCTCCCCTAGGAGGTGTAAGTCT AGCCACAGCTGTGGTGACCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 15, 3: 42, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!