ID: 925681414_925681417

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 925681414 925681417
Species Human (GRCh38) Human (GRCh38)
Location 2:6425623-6425645 2:6425640-6425662
Sequence CCTGTGCTTCCTCCTCTGGCTCC GGCTCCCTTTCAGCCACACCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!