ID: 925722137_925722140

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 925722137 925722140
Species Human (GRCh38) Human (GRCh38)
Location 2:6839625-6839647 2:6839674-6839696
Sequence CCTTGTTCCTTCTTAGTCTCCAG CATACTGTTGCAATTATTTAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 40, 4: 407} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!