ID: 925741531_925741533

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 925741531 925741533
Species Human (GRCh38) Human (GRCh38)
Location 2:7009285-7009307 2:7009300-7009322
Sequence CCTGCAAAGCAGGATCATCTTGT CATCTTGTTCTGTAGCTGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 116} {0: 1, 1: 0, 2: 1, 3: 17, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!