ID: 925742157_925742167

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 925742157 925742167
Species Human (GRCh38) Human (GRCh38)
Location 2:7015433-7015455 2:7015469-7015491
Sequence CCTCCACTGGGCCCTGAATAGTC CAGGCCTGATGCAGACCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 137} {0: 1, 1: 1, 2: 4, 3: 24, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!