ID: 925838067_925838073

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 925838067 925838073
Species Human (GRCh38) Human (GRCh38)
Location 2:7965162-7965184 2:7965202-7965224
Sequence CCCCGTAAAATGATTTTTCCTTA ACTTACTTCCCCCAACTGTAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 271} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!