ID: 925864773_925864780

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 925864773 925864780
Species Human (GRCh38) Human (GRCh38)
Location 2:8217828-8217850 2:8217847-8217869
Sequence CCTGCCCCCACTTCTATTTTAAT TAATGATAGGCATGGACAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 87, 4: 604} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!