ID: 925909909_925909911

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 925909909 925909911
Species Human (GRCh38) Human (GRCh38)
Location 2:8566922-8566944 2:8566943-8566965
Sequence CCGTGACCATAAATTGTTGGTGA GAGCCATCTCACCTATTGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99} {0: 1, 1: 0, 2: 0, 3: 10, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!