|
Left Crispr |
Right Crispr |
| Crispr ID |
925938654 |
925938660 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:8793370-8793392
|
2:8793401-8793423
|
| Sequence |
CCTGTAGTTCCAAGTACTCAGGA |
TGGGAGCATCGCTTAAGCCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 159, 2: 4424, 3: 59438, 4: 184164} |
{0: 3, 1: 275, 2: 5422, 3: 32847, 4: 75482} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|