ID: 925943696_925943699

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 925943696 925943699
Species Human (GRCh38) Human (GRCh38)
Location 2:8841832-8841854 2:8841848-8841870
Sequence CCGTCCATGCTCCTTGCTGGCTT CTGGCTTTCACCTGAGTTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 408} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!