ID: 925955028_925955033

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 925955028 925955033
Species Human (GRCh38) Human (GRCh38)
Location 2:8955018-8955040 2:8955048-8955070
Sequence CCTGCCCCAGGCTTGCAATGGAG CAATTCTAGCCCTACAGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 216} {0: 1, 1: 1, 2: 5, 3: 7, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!