ID: 925990419_925990423

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 925990419 925990423
Species Human (GRCh38) Human (GRCh38)
Location 2:9250138-9250160 2:9250187-9250209
Sequence CCATGATCTCCTTGGGGGCAGAA ACACGCTGCCTGACACAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 307} {0: 1, 1: 1, 2: 2, 3: 16, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!