ID: 925993905_925993911

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 925993905 925993911
Species Human (GRCh38) Human (GRCh38)
Location 2:9276277-9276299 2:9276302-9276324
Sequence CCTTCTCAGGAGAGAGGAGTGTG CACGGGCTGGGAAGACAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 237} {0: 1, 1: 0, 2: 6, 3: 31, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!