ID: 925994627_925994631

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 925994627 925994631
Species Human (GRCh38) Human (GRCh38)
Location 2:9281993-9282015 2:9282042-9282064
Sequence CCTTCTTCCCTCTGCTCATGCTC CACTTTATGAAAGAAAACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 95, 4: 758} {0: 1, 1: 1, 2: 2, 3: 33, 4: 399}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!