ID: 926081599_926081601

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 926081599 926081601
Species Human (GRCh38) Human (GRCh38)
Location 2:9991022-9991044 2:9991051-9991073
Sequence CCAGTCTTGAAAAATGACAACAC CATGAATCACTGTTAAAATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 390} {0: 1, 1: 0, 2: 4, 3: 25, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!