ID: 926089993_926090017

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 926089993 926090017
Species Human (GRCh38) Human (GRCh38)
Location 2:10043517-10043539 2:10043566-10043588
Sequence CCGCTCCCTCCGCGGCCGCCCCG CGGGGCAGAGCCGCGCGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 7, 3: 104, 4: 833} {0: 1, 1: 0, 2: 1, 3: 42, 4: 397}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!