ID: 926095690_926095705

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 926095690 926095705
Species Human (GRCh38) Human (GRCh38)
Location 2:10079821-10079843 2:10079870-10079892
Sequence CCGGCGCCCAGGGCTGGGGCGGG CGCCGTCCCCCGAGGCCCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 85, 4: 659} {0: 1, 1: 0, 2: 1, 3: 17, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!