ID: 926101420_926101428

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 926101420 926101428
Species Human (GRCh38) Human (GRCh38)
Location 2:10120679-10120701 2:10120696-10120718
Sequence CCGCAGCGGGGCAAAGTTGCCGG TGCCGGACCTGGGGGCAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 42, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!