ID: 926108580_926108585

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 926108580 926108585
Species Human (GRCh38) Human (GRCh38)
Location 2:10167766-10167788 2:10167803-10167825
Sequence CCTGTCCTCATCTGAAGATAACT TCTCTTCCCACACAAGGCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 367} {0: 1, 1: 1, 2: 2, 3: 27, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!