ID: 926112979_926112988

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 926112979 926112988
Species Human (GRCh38) Human (GRCh38)
Location 2:10194586-10194608 2:10194599-10194621
Sequence CCCCAACCACCGGTGGGCCCCGG TGGGCCCCGGGTGGCTTGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 199} {0: 1, 1: 0, 2: 2, 3: 20, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!