ID: 926142708_926142721

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 926142708 926142721
Species Human (GRCh38) Human (GRCh38)
Location 2:10377803-10377825 2:10377824-10377846
Sequence CCCATCCCCAGGGTGGTGAGCCA CACCGAGGGGGGCCAGGCACGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 280} {0: 1, 1: 0, 2: 0, 3: 19, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!