ID: 926145741_926145754

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 926145741 926145754
Species Human (GRCh38) Human (GRCh38)
Location 2:10396307-10396329 2:10396355-10396377
Sequence CCAGTCAAGAAACCGTGGAGGCT ACAGTCGTGGGTGGCAGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67} {0: 1, 1: 0, 2: 0, 3: 17, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!