ID: 926145847_926145854

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 926145847 926145854
Species Human (GRCh38) Human (GRCh38)
Location 2:10396814-10396836 2:10396844-10396866
Sequence CCTGTCGCTCTTCTCTTCCAGGG CTAGTGGCCCAGTCAGGACGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 214} {0: 1, 1: 0, 2: 1, 3: 7, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!