ID: 926161517_926161524

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 926161517 926161524
Species Human (GRCh38) Human (GRCh38)
Location 2:10493458-10493480 2:10493477-10493499
Sequence CCGCCTCCCAGGTGCCAAGCCCT CCCTTTAACCACAAGGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 549} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!