ID: 926167337_926167339

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 926167337 926167339
Species Human (GRCh38) Human (GRCh38)
Location 2:10529729-10529751 2:10529742-10529764
Sequence CCTGAGTGGCTTCCAGGATTGGC CAGGATTGGCACAGACCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 11, 4: 149} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!