ID: 926180706_926180708

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 926180706 926180708
Species Human (GRCh38) Human (GRCh38)
Location 2:10640662-10640684 2:10640677-10640699
Sequence CCCTCATACTCATGCTAATTAAA TAATTAAAGTCACCATTACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 194} {0: 1, 1: 0, 2: 0, 3: 15, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!