ID: 926195130_926195137

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 926195130 926195137
Species Human (GRCh38) Human (GRCh38)
Location 2:10759100-10759122 2:10759132-10759154
Sequence CCTATCTCCTCCGGGGGCATTTA TGCCTGCAGCCGGTCAGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 62} {0: 1, 1: 0, 2: 0, 3: 11, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!