ID: 926195512_926195527

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 926195512 926195527
Species Human (GRCh38) Human (GRCh38)
Location 2:10761417-10761439 2:10761469-10761491
Sequence CCGCCATCCTCCTGGTTACCCTC GGGCCTGTACCCTTGCTACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 386} {0: 1, 1: 0, 2: 0, 3: 4, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!