ID: 926203314_926203319

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 926203314 926203319
Species Human (GRCh38) Human (GRCh38)
Location 2:10816876-10816898 2:10816901-10816923
Sequence CCAAGACCCACACTGGGCATGTG TGGCACACTATAGGCTTTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 264} {0: 1, 1: 0, 2: 0, 3: 10, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!