ID: 926209888_926209901

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 926209888 926209901
Species Human (GRCh38) Human (GRCh38)
Location 2:10862052-10862074 2:10862088-10862110
Sequence CCTCCCCAGTGCAGTCTTTACAT GTGGGGAAGTCCCTGAAAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 28, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!