ID: 926247913_926247915

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 926247913 926247915
Species Human (GRCh38) Human (GRCh38)
Location 2:11134058-11134080 2:11134100-11134122
Sequence CCAAAAAGCAAGCAGAGAAGCAA AAGTGTGACCAGCGGTAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 82, 4: 624} {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!