ID: 926259894_926259896

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 926259894 926259896
Species Human (GRCh38) Human (GRCh38)
Location 2:11249670-11249692 2:11249697-11249719
Sequence CCAGGGGCTATTGGCAAAGGCCA ATCTCTTTCTTCCCAAAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 203} {0: 1, 1: 0, 2: 1, 3: 39, 4: 444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!