ID: 926261760_926261762

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 926261760 926261762
Species Human (GRCh38) Human (GRCh38)
Location 2:11270475-11270497 2:11270492-11270514
Sequence CCATTACACATATTTTACACCTT CACCTTTTCTAGTGGTTCCATGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 20, 3: 76, 4: 463} {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!