ID: 926283045_926283056

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 926283045 926283056
Species Human (GRCh38) Human (GRCh38)
Location 2:11465913-11465935 2:11465957-11465979
Sequence CCCACGAGCTCTCCCGCCCTCTC CCCCACGCGCCGATTTCCAAGGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 1, 3: 8, 4: 241} {0: 6, 1: 0, 2: 0, 3: 4, 4: 27}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!