ID: 926291513_926291520

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 926291513 926291520
Species Human (GRCh38) Human (GRCh38)
Location 2:11534899-11534921 2:11534939-11534961
Sequence CCACAGGGGGCGCTGGTGTCTGG GTGCTCAGGACAGAATCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 213} {0: 1, 1: 1, 2: 2, 3: 23, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!