ID: 926294363_926294368

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 926294363 926294368
Species Human (GRCh38) Human (GRCh38)
Location 2:11558071-11558093 2:11558112-11558134
Sequence CCACAAAGTGCTTTCACCTCACA CTGTGATTTGGGAAGATGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 87, 4: 716} {0: 1, 1: 0, 2: 3, 3: 41, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!