ID: 926304946_926304953

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 926304946 926304953
Species Human (GRCh38) Human (GRCh38)
Location 2:11631141-11631163 2:11631185-11631207
Sequence CCATGAGCACCAGCTGCATGCAC AGGAATTCAGAGGGAGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 224} {0: 1, 1: 0, 2: 5, 3: 46, 4: 463}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!