ID: 926306050_926306054

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 926306050 926306054
Species Human (GRCh38) Human (GRCh38)
Location 2:11637874-11637896 2:11637895-11637917
Sequence CCCAGTGCTGTCTGTCGACTGTT TTACCTGAACCTGGGATCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 134} {0: 1, 1: 0, 2: 0, 3: 17, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!