ID: 926309762_926309766

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 926309762 926309766
Species Human (GRCh38) Human (GRCh38)
Location 2:11667038-11667060 2:11667052-11667074
Sequence CCAGCAGCCATGTTCTTGTCCTG CTTGTCCTGTGGACAGACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 207} {0: 1, 1: 2, 2: 2, 3: 27, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!