ID: 926309762_926309769

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 926309762 926309769
Species Human (GRCh38) Human (GRCh38)
Location 2:11667038-11667060 2:11667083-11667105
Sequence CCAGCAGCCATGTTCTTGTCCTG CGCTACCCACAGACACCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 207} {0: 1, 1: 0, 2: 6, 3: 11, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!