ID: 926312105_926312111

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 926312105 926312111
Species Human (GRCh38) Human (GRCh38)
Location 2:11682254-11682276 2:11682290-11682312
Sequence CCACCTGGAAACCCAACCACAGT TTTCTTAGTGACAGGAAATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 201} {0: 1, 1: 0, 2: 1, 3: 30, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!