|
Left Crispr |
Right Crispr |
| Crispr ID |
926312601 |
926312606 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:11685415-11685437
|
2:11685431-11685453
|
| Sequence |
CCTGTTGGGAGGCTGTTGCAATA |
TGCAATAATCCAAGTGGGAGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 9, 2: 39, 3: 201, 4: 782} |
{0: 1, 1: 1, 2: 4, 3: 30, 4: 179} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|