ID: 926315238_926315246

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 926315238 926315246
Species Human (GRCh38) Human (GRCh38)
Location 2:11704831-11704853 2:11704883-11704905
Sequence CCAGAGGCCACACACACTTATGT GGGGACTAGCTAGTCATCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 148} {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!