ID: 926327129_926327133

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 926327129 926327133
Species Human (GRCh38) Human (GRCh38)
Location 2:11795094-11795116 2:11795122-11795144
Sequence CCCTTGATCAAGCATTTGCATAA AGTGATGATGGAGTTTGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163} {0: 1, 1: 0, 2: 0, 3: 23, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!