ID: 926328120_926328125

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 926328120 926328125
Species Human (GRCh38) Human (GRCh38)
Location 2:11802970-11802992 2:11802993-11803015
Sequence CCACCTCCCTCTTCTGCCTAATG TCAGCTACAAGAAGACTCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 547} {0: 1, 1: 0, 2: 1, 3: 9, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!