ID: 926352344_926352346

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 926352344 926352346
Species Human (GRCh38) Human (GRCh38)
Location 2:12007577-12007599 2:12007596-12007618
Sequence CCAGGCTGAGTTCCTCAACACAT ACATTTTTTCATCTGTAAAATGG
Strand - +
Off-target summary No data {0: 2, 1: 10, 2: 230, 3: 1364, 4: 6087}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!