ID: 926396221_926396226

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 926396221 926396226
Species Human (GRCh38) Human (GRCh38)
Location 2:12445545-12445567 2:12445566-12445588
Sequence CCCCAATGACTCCTGCTTAGGTG TGGTCACAAGATGCATCTTCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 7, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!