ID: 926423878_926423885

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 926423878 926423885
Species Human (GRCh38) Human (GRCh38)
Location 2:12724053-12724075 2:12724074-12724096
Sequence CCAGCTCAGAATAGAGGTCCGTG TGCTGGGTGGGATGAGAACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63} {0: 1, 1: 0, 2: 2, 3: 38, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!