ID: 926481524_926481526

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 926481524 926481526
Species Human (GRCh38) Human (GRCh38)
Location 2:13402751-13402773 2:13402796-13402818
Sequence CCATAAAGGAGATACAATCAATA ATGATCAAGTGGAATTAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 253} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!